HTLV-1 primers: a list of some that have been published in the scientific literature

In recent weeks there has been a surge in media interest about a virus called human T-lymphotropic virus I (HTLV-1) that is present among the Indigenous Australians living in communities around the centre of Australia.

An example of a real-time PCR curve. The fluorescent signal is generated by increasing amounts of the intended target DNA through the PCR process.

One aspect of this story that sticks with me – one of several seriously disappointing aspects – is the description of a 6-month turnaround time for virus testing results.

Specifically, for testing how much virus is present in the cells of an infected person; viral load testing.

I’m not goingย into virus or disease background in this post but I am going to list some scientific publications that describe the reagents previously published to detect HTLV-1 genetic sequences, and in some cases, to quantify that viral load.

Just to be clear, this is not leading-edge technology. These molecular methods, based on PCR techniques, are pretty old – but reliable – tech.

Setting up and performing these tests is bread-and-butter work for any expert and suitably accredited laboratory of which Australia has quite a few. Because the test itself and performing the test and reporting the test’s results are not hurdles, the issues around this not being a commonplace quick turnaround offering must lie elsewhere. To date, it seems that high-level testing has been run off the back of research funding for which we can thank a range of clever medical researchers.

Australia has known about this virus and the diseases it can and does cause or be associated with, for decades.

I think it’s well beyond time that we expected more to be done about this health problem. Hopefully, the recent media attention will jog this process along.

NameSequence (5'-3')StudyTarget region
Forward primer SK 110CCCTACAATCCAACCAGCTCAGArruda et al. Rev. Bras. Hematol. Hemoter. 2008; 30(5):384-389pol
Reverse primerSK 111GTGGTGAAGCTGCCA TCGGGTTTTArruda. Rev. Bras. Hematol. Hemoter. 2008; 30(5):384-389pol
Signal generation-SYBR greenArruda. Rev. Bras. Hematol. Hemoter. 2008; 30(5):384-389pol
Forward primer HTLV-1F1GCCCTAATAATTCTACCCGAAGACTCastro et al. J Virol Methods. 2013 189(2):383-7tax
Reverse primerHTLV-1R1GGTTGAGTGGAACGGAAGGACastro et al. J Virol Methods. 2013 189(2):383-7tax
Signal generation-SYBR greenCastro et al. J Virol Methods. 2013 189(2):383-7tax
Forward primer
(sublineage A/C)
NP88CTCCTCCCCCTGTCATAACTCPripuzova et al. PLOSONE. 2012 7(8):e43246env
Reverse primer
(sublineage A/C)
NP89GAGACAAGCCAGACYGCCACPripuzova et al. PLOSONE. 2012 7(8):e43246env
Signal generation-SYBR greenPripuzova et al. PLOSONE. 2012 7(8):e43246env
Forward primer
(sublineage A/C)
NP90GCRRCAGGCCCTGTCACAGPripuzova et al. PLOSONE. 2012 7(8):e43246pol
Reverse primer
(sublineage A/C)
NP91GTGGTGCCAGTGAGGGTYAGCPripuzova et al. PLOSONE. 2012 7(8):e43246pol
Signal generation-SYBR greenPripuzova et al. PLOSONE. 2012 7(8):e43246pol
Forward primer
(sublineage A)
NP47GRTTACCGGCYCCATGTCCCPripuzova et al. PLOSONE. 2012 7(8):e43246env
Reverse primer
(sublineage A)
NP48CRGCACTGTTCTTGTAATGCTTTGCPripuzova et al. PLOSONE. 2012 7(8):e43246env
Signal generation-SYBR greenPripuzova et al. PLOSONE. 2012 7(8):e43246env
Forward primer HTLV-I-FAGCCCCTTCACAGTCTCTACTJi-zhen et al. 2009 Bing Du Xue Bao. 25(5):339-43.gag-pro-pol
Reverse primerHTLV-I- RGCAGGGTTTGGACT AGTCTACTGJi-zhen et al. 2009 Bing Du Xue Bao. 25(5):339-43.gag-pro-pol
Signal generationHTLV-I-PFAM - CCTGTCACAGAACT GC - MGBJi-zhen et al. 2009 Bing Du Xue Bao. 25(5):339-43.gag-pro-pol
Forward primer forwardAGTTCGGAGCTC AGGTCGAGAEinsiedel et al. 2016. BMC Public Health. 16:787gag
Reverse primerreverseAGCAAGCAGGGTCAGGCAAAGEinsiedel et al. 2016. BMC Public Health. 16:787gag
Signal generationprobeFAM - GTCCGGCGCTCCCTTAGAGCC - BHQ1Einsiedel et al. 2016. BMC Public Health. 16:787gag

References…

  1. World experts call for Australia to act on devastating HTLV-1 virus
    https://www.theguardian.com/australia-news/2018/apr/28/world-experts-call-for-australia-to-act-on-devastating-htlv-1-virus?CMP=share_btn_tw
  2. ‘People are scared’: the fight against a deadly virus no one has heard of
    https://www.theguardian.com/australia-news/2018/apr/24/people-are-scared-the-fight-against-a-deadly-virus-no-one-has-heard-of

Discover more from Virology Down Under

Subscribe to get the latest posts sent to your email.