
In recent weeks there has been a surge in media interest about a virus called human T-lymphotropic virus I (HTLV-1) that is present among the Indigenous Australians living in communities around the centre of Australia.

One aspect of this story that sticks with me – one of several seriously disappointing aspects – is the description of a 6-month turnaround time for virus testing results.
Specifically, for testing how much virus is present in the cells of an infected person; viral load testing.
I’m not going into virus or disease background in this post but I am going to list some scientific publications that describe the reagents previously published to detect HTLV-1 genetic sequences, and in some cases, to quantify that viral load.
Just to be clear, this is not leading-edge technology. These molecular methods, based on PCR techniques, are pretty old – but reliable – tech.
Setting up and performing these tests is bread-and-butter work for any expert and suitably accredited laboratory of which Australia has quite a few. Because the test itself and performing the test and reporting the test’s results are not hurdles, the issues around this not being a commonplace quick turnaround offering must lie elsewhere. To date, it seems that high-level testing has been run off the back of research funding for which we can thank a range of clever medical researchers.
Australia has known about this virus and the diseases it can and does cause or be associated with, for decades.
I think it’s well beyond time that we expected more to be done about this health problem. Hopefully, the recent media attention will jog this process along.
| Name | Sequence (5'-3') | Study | Target region | |
|---|---|---|---|---|
| Forward primer | SK 110 | CCCTACAATCCAACCAGCTCAG | Arruda et al. Rev. Bras. Hematol. Hemoter. 2008; 30(5):384-389 | pol |
| Reverse primer | SK 111 | GTGGTGAAGCTGCCA TCGGGTTTT | Arruda. Rev. Bras. Hematol. Hemoter. 2008; 30(5):384-389 | pol |
| Signal generation | - | SYBR green | Arruda. Rev. Bras. Hematol. Hemoter. 2008; 30(5):384-389 | pol |
| Forward primer | HTLV-1F1 | GCCCTAATAATTCTACCCGAAGACT | Castro et al. J Virol Methods. 2013 189(2):383-7 | tax |
| Reverse primer | HTLV-1R1 | GGTTGAGTGGAACGGAAGGA | Castro et al. J Virol Methods. 2013 189(2):383-7 | tax |
| Signal generation | - | SYBR green | Castro et al. J Virol Methods. 2013 189(2):383-7 | tax |
| Forward primer (sublineage A/C) | NP88 | CTCCTCCCCCTGTCATAACTC | Pripuzova et al. PLOSONE. 2012 7(8):e43246 | env |
| Reverse primer (sublineage A/C) | NP89 | GAGACAAGCCAGACYGCCAC | Pripuzova et al. PLOSONE. 2012 7(8):e43246 | env |
| Signal generation | - | SYBR green | Pripuzova et al. PLOSONE. 2012 7(8):e43246 | env |
| Forward primer (sublineage A/C) | NP90 | GCRRCAGGCCCTGTCACAG | Pripuzova et al. PLOSONE. 2012 7(8):e43246 | pol |
| Reverse primer (sublineage A/C) | NP91 | GTGGTGCCAGTGAGGGTYAGC | Pripuzova et al. PLOSONE. 2012 7(8):e43246 | pol |
| Signal generation | - | SYBR green | Pripuzova et al. PLOSONE. 2012 7(8):e43246 | pol |
| Forward primer (sublineage A) | NP47 | GRTTACCGGCYCCATGTCCC | Pripuzova et al. PLOSONE. 2012 7(8):e43246 | env |
| Reverse primer (sublineage A) | NP48 | CRGCACTGTTCTTGTAATGCTTTGC | Pripuzova et al. PLOSONE. 2012 7(8):e43246 | env |
| Signal generation | - | SYBR green | Pripuzova et al. PLOSONE. 2012 7(8):e43246 | env |
| Forward primer | HTLV-I-F | AGCCCCTTCACAGTCTCTACT | Ji-zhen et al. 2009 Bing Du Xue Bao. 25(5):339-43. | gag-pro-pol |
| Reverse primer | HTLV-I- R | GCAGGGTTTGGACT AGTCTACTG | Ji-zhen et al. 2009 Bing Du Xue Bao. 25(5):339-43. | gag-pro-pol |
| Signal generation | HTLV-I-P | FAM - CCTGTCACAGAACT GC - MGB | Ji-zhen et al. 2009 Bing Du Xue Bao. 25(5):339-43. | gag-pro-pol |
| Forward primer | forward | AGTTCGGAGCTC AGGTCGAGA | Einsiedel et al. 2016. BMC Public Health. 16:787 | gag |
| Reverse primer | reverse | AGCAAGCAGGGTCAGGCAAAG | Einsiedel et al. 2016. BMC Public Health. 16:787 | gag |
| Signal generation | probe | FAM - GTCCGGCGCTCCCTTAGAGCC - BHQ1 | Einsiedel et al. 2016. BMC Public Health. 16:787 | gag |
References…
- World experts call for Australia to act on devastating HTLV-1 virus
https://www.theguardian.com/australia-news/2018/apr/28/world-experts-call-for-australia-to-act-on-devastating-htlv-1-virus?CMP=share_btn_tw - ‘People are scared’: the fight against a deadly virus no one has heard of
https://www.theguardian.com/australia-news/2018/apr/24/people-are-scared-the-fight-against-a-deadly-virus-no-one-has-heard-of
Discover more from Virology Down Under
Subscribe to get the latest posts sent to your email.
