Kits, reagents and viruses

The COVID-19 pandemic has driven use of the words “kit” and “reagent”. I completely feel for you if you still have no real idea of what is meant by the labels in any given story. But be confuddled no longer! You will soon be as hip in this lingo of the lab as anyone can be. Let’s explore these terms as they apply severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) testing, which is all about detecting a tiny bit of the unique genetic sequence that makes this virus different from that virus and different from a cabbage. If it’s present in our respiratory tract swab specimen or course.

A swab. Image by Ewa Urban from Pixabay

The process

Before we get to those two words though, I’m going to walk you through the process we use to test a suspect person’s specimen for SARS-CoV-2 (severe acute respiratory syndrome coronavirus 2), the virus that causes coronavirus disease 2019 (COVID-19).

I’ve thrown together a graphic below. Its intent is just to give you a basic idea of the timing for a single patient’s sample and of the steps involved. Your experience (patient of scientist) may vary.

Of course, a lab doesn’t usually test one sample at a time. There would be some pretty epic delays if we did. So imagine the difference in the time it takes to make scrambled eggs, toast and coffee for one person versus 3,000 people. You can probably see that these numbers will scale up and some labs will be able to cope with that better than others. Sometimes it’s actually faster to test more than one at a time because of the way testing is done. For example, we could deliver 96 samples to the lab faster in one trip than in 96 single trips. We can also run other steps in batches. But we still have to report out a lot of individual results at the other end, and answer questions. So swings and roundabouts. But I’m sure you get the idea.

An example of the process of testing one sample for one virus.

The sample: extracting the wheat from the chaff

When we test for SARS-CoV-2, we don’t want all the gunk that comes from up your nose or throat or down in your lungs in our testing tube. We just want the virus’s genetic material. Apart from being gluggy and disgusting, that gunk can make our test fail as some of its elements inhibit the enzymatic reaction that is at the heart of our test.

Once a sample has been collected, sent to the lab and logged in, a portion goes on to a different spot in the lab/different lab where we clear out the protein and the carbohydrates and salts and cells and this morning’s breakfast. We call this step nucleic acid “extraction” or “purification”.

NOTE: we get DNA and RNA in this process and all of what I’m talking about here can apply to the process for testing for any of the 200 or so respiratory viruses.

This can be done in different ways but the most common is a multistep process which essentially:

  • busts open any cells (human or bacterial) or viruses
  • dissolves and washes away the crud while capturing the nucleic acids present from the newly created biological soup
  • washes a bit more to get rid of salts and generally rinses
  • changes the chemical balance and washes (“elutes”) the now pure nucleic acids into a tiny volume (we may start with 200µl [millionths of a litre] of a sample, finishing up with about 60µl of “extract”

This process can be done by hand – manually – with pipetting steps and centrifugation to remove waste liquids and swapping and discarding of tubes and lots of labelling and so on.

It can also be done in a semi- or fully-automated way using extraction or “liquid-handling” robots.

The best nucleic acid extraction systems let us add the original patients’ sample in one end, walk away (seldom has this been my experience but that may say more about me than the robots) and collect the extract at either end once the process is complete. Robots can be more reliable, use kits that have been made with a quality-assured process, reduce the risk of cross-contaminating one sample with droplets from another, need way less hand-labelling and generally have much higher throughput than the manual process.

This is essential when you have thousands of samples awaiting testing each day and need things to go smoothly, freeing you up to use your big brain on other things.

DIAGNOSTICS vs RESEARCH: Research labs will generally do things manually and swear by that (including making their own extraction reagents 🙄), whereas professional diagnostic labs will use automation whenever they can, and swear by that because quality assurance.

The test: seeking SARS-CoV-2 through amplification

This bit is more technical. We usually take 5µl of the colourless nucleic acids extract. We add that to about 15µl of a mix made up of different chemicals, molecules and mixtures (reagents-see below). We can call this the reaction mix.

The reaction mix

In this mix we’ve added primers, a probe labelled with a molecule that can fluoresce when broken off the probe, some buffer, nucleotides (the “building blocks” of the DNA strands we’re about to exponentially make in the tube), an enzyme that makes a DNA copy from an RNA template (which is the SARS-CoV-2’s genetic material) and one that makes lots of DNA (sometimes one enzyme performs both functions) from each newly made DNA copy.

THE ENZYMES: the enzyme we use are called polymerases. These make a copy – a new chain of nucleotide – of a template strand, starting from where a primer is bound, and adding the appropriate complementary nucleotide one after another, in a new growing chain – or DNA strand. We call the lab method that harnesses these enzymes, the polymerase chain reaction, or PCR. When our virus uses RNA to carry around its genetic code, like SARS-CoV-2, we have to add a step to our PCR. We make a DNA copy of the RNA using an RNA-dependent DNA polymerase and add a step called reverse transcription (RT). Not the test is called an RT-PCR.

A model of a DNA copying polymerase that we used for PCR test from https://www.rcsb.org/structure/1tau.[1]

The enzymes need the primers to bind to their target to set up their copying activities. The probe binds to the newly made DNA chains if the virus is present. If the target virus isn’t present or is there but in too small an amount, the test will return a negative result.

GETTING A LOT FROM MUCH LESS: Compared to what used to be the gold standard for detecting virus from sick patents, growth in permissive cell cultures – the PCR method we used today is hundred to thousands of times more sensitive.

The primer-target and probe-target binding is really specific. If we’ve done our primer and probe design job properly, we won’t get a positive result to a different coronavirus or a virus from a different family of viruses. The version of This is called a real-time (r) reverse transcriptase (RT) polymerase chain reaction (PCR), or RT-rPCR, mix. (I’ve written about PCR and RT-PCR but both blogs need some work)

The primers and probe are designed to match/reflect the sequence of the virus and so it won’t bind well to any different sequence.

Every different thing with a genome is genetically distinct, even different viruses. All the species have unique genetic codes. We design our primers to seek out the unique bits of the SARS-CoV-2 genome (sometimes the sarbecoviruses as a group), but not the same genetic region of, say, HCoV-229E. This is because the sequence in that same region is different between eth two viruses.

This feature makes PCR highly specific to the target of choice. The cyclical nature of PCR makes it highly sensitive.

NOTE We know there’ll be a genetic difference because when we designed out PCR test, we sat down and compared all the viruses in the family, and – as best as we could predict – chose regions that would be unique.

The yellow highlighted nucleotide sequence in the middle of this alignment is a SARS-CoV-2-specific probe.

Once we have the primers in the lab, we verify they do what we expect by actually testing other viruses and making sure we get on “false positives”.

How does a “kit” fit in?

Because diagnostic labs need to move samples through at speed and need the process to work and be high quality, they will not spend their time making all the different chemical mixtures needed to extract nucleic acids or the buffers and enzymes and primers and probes used in the PCR mix. The lab will buy them in from companies who specialise in making quality materials over and over and at scale.

We can buy extraction chemicals in a kit. The kit provides everything premade, sometimes prediluted and ready to plug ‘n play. We also need to buy some disposable plasticware like the many (oh so many!) pipette tips that fit onto the automated pipettors and maybe some tubes and other bits and pieces. Then we can add those liquids and plates and troughs and plasticware to the robots and away we go.

We can also buy primers and primers either individually or they can be supplied in kits – where they come pre-made labelled and put in tubes with instructions for how to use them.

Lastly, we can buy PCR or RT-PCR kits – these come with the buffer already containing nucleotides and enzyme, or with them kept separately, sometimes other chemical and usually with some high-grade water.

What is a “reagent”?

A reagent is a term used widely in the lab – basically for anything chemical. A culture flask or a pipette tip sin;t a reagent (we call them consumables it plasticware). A pipette or a bottle isn’t a reagent, they are, well, they’re pipettes and bottles. D’uh.

We use the word for the ingredients in our experiments. They can be pure chemicals or mixtures, powders or crystalline (salts or sugars), or powders. A solid or a liquid. A reagent can be an acid or a base, water, a buffered salt solution or an enzyme in glycerol. In the case of our story, reagents can be individual primers and probes or the mixtures and buffers that make up the extraction kits. The word is pretty broadly used.

What was in short supply early in the COVID-19 pandemic?

About three weeks ago there was lots of talk about COVID-19-related shortages, mostly of “kits”.[3,10] These shortages were driven by the sudden increased demand for RNA extraction kits and for getting them delivered when international transport was becoming an issue.[6,7,8,9]

Although some companies were not seeing any problem [2] others were in greater demand because labs have preferences. Some companies were more popular, or better able to get their robots (which use specific recipes provided by kits sold by the same company) into more labs, than others.

Nucleic acid extraction market leaders.[14]

One fallout from this pandemic is that labs may look to more broadly diversify their reliance on any given supplier. And another may that companies developed processes to more quickly surge production capacity including ensuring stocks of key reagents needed in those kits.

But labs can’t just jump ship to another extraction format overnight. Each kit comes from a different company and usually entails changing an established familiar method, or an entire platform (equipment plus kits and plasticware), to something that is new and unfamiliar. Such a change also requires time to ensure the new platform will deliver on what the specific lab needs (size, throughput, turnaround time, speciality, future need) and that its ongoing use won’t, in eth long term, unnecessarily blow out the budget compared other current method.

After this pandemic is finally over, I think we’ll see enhanced lab capacity in labs all over the world. And hopefully a better understanding of how important testing is.

Other lab-related shortages

We’ve also read about shortages of the swabs used to collect specimens from suspected cases [5,11] and of SARS-CoV-2- specific testing kits.[4,11] And of course, shortages of personal protective equipment including gloves.

Within a very short period after the genetic sequence of the SARS-CoV-2 was put online, flexible labs all around the world had designed and ordered their own primers and probes to set up “in-house” tests for SARS-CoV-2. If they didn’t have a virus themselves, then they could optimise their new tests by designing and ordering a piece of the DNA that would span the region that included the primer and probe binding sites. Unfortunately, because of the way companies make their primers and probes and longer DNA strands, this resulted in at least some having their primer and probe manufacturing processes contaminated by those “synthetic” controls.[12,13]

A message from one company that produces primers and probes for real-time PCR methods.

Summary

So hopefully this explains what a kit is and what reagents are and some context for what was happening around their use, and shortages, early on in the pandemic. If not – ask me a question below and I’ll add more info into this post.

References

  1. The Protein Data Bank H.M. Berman, J. Westbrook, Z. Feng, G. Gilliland, T.N. Bhat, H. Weissig, I.N. Shindyalov, P.E. Bourne (2000) Nucleic Acids Research, 28: 235-242. doi:10.1093/nar/28.1.235
  2. Availability of RNA Isolation Kits Not as Dire as Reported
    https://www.biocompare.com/Life-Science-News/561924-Availability-of-RNA-Isolation-Kits-Not-as-Dire-as-Reported/
  3. Global shortage of Covid-19 test kits hits Australia as other nations limit exports
    https://www.theguardian.com/australia-news/2020/mar/13/global-shortage-of-covid-19-test-kits-hits-australia-as-other-nations-limit-exports
  4. Shortage of kits delays labs from testing Covid-19
    https://economictimes.indiatimes.com/news/politics-and-nation/shortage-of-kits-delays-labs-from-testing-covid-19/articleshow/74858534.cms?from=mdr
  5. US virus testing faces new headwind: Lab supply shortages
    https://abcnews.go.com/Health/wireStory/us-virus-testing-faces-headwind-lab-supply-shortages-69710161
  6. Shortage of RNA extraction kits hampers efforts to ramp up COVID-19 coronavirus testing
    https://cen.acs.org/analytical-chemistry/diagnostics/Shortage-RNA-extraction-kits-hampers/98/web/2020/03
  7. QIAGEN dramatically ramping up global production capacity for RNA extraction kits for use in detection of SARS-CoV-2 coronavirus
    https://corporate.qiagen.com/newsroom/press-releases/2020/20200317_capacity_increase
  8. Supply chain issues hit testing ramp-up: Roche Diagnostics India MD Shravan Subramanyam
    https://economictimes.indiatimes.com/industry/healthcare/biotech/healthcare/supply-chain-issues-hit-testing-ramp-up-roche-diagnostics-india-md-shravan-subramanyam/articleshow/75076431.cms
  9. Shortage of crucial chemicals creates new obstacle to U.S. coronavirus testing
    https://www.statnews.com/2020/03/10/shortage-crucial-chemicals-us-coronavirus-testing/comment-page-1/
  10. Here are the coronavirus testing materials that are in short supply in the US
    https://qz.com/1822596/all-the-coronavirus-test-materials-in-short-supply-in-the-us/
  11. Severe shortages of swabs and other supplies hamper coronavirus testing
    https://edition.cnn.com/2020/03/18/us/coronovirus-testing-supply-shortages-invs/index.html
  12. Coronavirus Testing Kits Heading To UK Contaminated With COVID-19
    https://travelnoire.com/coronavirus-testing-kits-contaminated
  13. Coronavirus testing effort hampered by kits contaminated with Covid-19
    https://www.telegraph.co.uk/news/2020/03/30/uks-attempt-ramp-coronavirus-testing-hindered-key-components/
  14. Shortage of RNA extraction kits threatens coronavirus testing
    https://www.scienceboard.net/index.aspx?sec=sup&sub=gen&pag=dis&ItemID=564

Hits: 1186

12 thoughts on “Kits, reagents and viruses”

    1. Yes – staffing is an issue. Ideally, they’d work in 2 separate shifts so that if someone in one shift got infected, the whole lab wouldn’t have to go down in quarantine.

  1. Hi Ian.
    Thanks for the great email and your ongoign tweets.
    You talked about shortages. Are these shortages resolved now, is Australia getting all the test components its needs, or are shortages likely to continue for some time?
    Thanks

    S

    1. Good question. I think we’re doing okay now. And it seems we’re diversifying; using other companies and platforms

  2. I’m wondering how labs are doing with culturing the virus …. and is that the only way to test for viral load?

    1. Labs have no trouble culturing virus when it present at decent amounts. We tend to use PCR-based methods to estimate viral load. They are reliable, so long as they have been set up correctly.

  3. Hi, I’m a PhD student in molecular and functional biology at the Swiss Centre for Scientific Research. I’d like to get the specific primers for human rhinoviruses A, B and C, please.

    1. I don’t know of species-specific primer sets. I’ve only used panHRV primers and then subgenomic sequencing. For this, I prefer modified versions (pg159, Arden et al) of the primers from Lu et al.

      I renamed them for my own group’s use…

      panHRV_LU_01_ mod2 CY+AGCC+TGCGTGGY
      panHRV_02.2 GAAACACGGACACCCAAAGTA
      panHRV_TM FAM-TCCTCCGGCCCCTGAATGYGGC-BHQ1

      1. Lu X, Holloway B, Dare RK, Kuypers J, Yagi S, Williams JV, Hall CB, Erdman DD. 2008. Real-time reverse transcription-PCR assay for comprehensive detection of humanrhinoviruses. J Clin Microbiol. 46(2):533-9.
      2. Arden KE, Mackay IM. 2010. Newly identified human rhinoviruses: molecular methods heat up the cold viruses. Rev Med Virol. 20(3):156-76.

Leave a Reply

This site uses Akismet to reduce spam. Learn how your comment data is processed.